About   Help   FAQ
D7Mit178 Primer Detail
Primers
  • Name
    D7Mit178
  • Primer 1 Sequence
    ACCTCTGATTTCAGAACCCTTG
  • Primer 2 Sequence
    TAGAGAGCCACTAGCATATCATAACC
  • ID
    MGI:702934
  • Product Size
    200
  • Other IDs
    D7Mit178 (BROAD)
  • Note
    MIT assay: MT1542
    Additional information: MIT STS Marker Data Files
Genes
D7Mit178 DNA segment, Chr 7, Massachusetts Institute of Technology 178
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit178 a 165bp A/J, AKR/J, BALB/cJ, LP/J, NOD/MrkTac, NON/ShiLt
b 177bp SPRET/EiJ
c 187bp C3H/HeJ, DBA/2J
d 201bp B6.Cg-Lepob/+, C57BL/6J
e 211bp CAST/EiJ
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D7Mit178 a larger 129P3/J
s smaller SJL/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D7Mit178 a 210bp C57BL/6W, C57BL/10W
b 187bp C3H/W, CBA/W, DBA/2W
c 165bp 129/SvW, A.CA/W, AKR/W, BALB/cW, BN/aW
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory