About   Help   FAQ
D16Mit88 Primer Detail
Primers
  • Name
    D16Mit88
  • Primer 1 Sequence
    GCAAATGTCCACACATGTACC
  • Primer 2 Sequence
    TATGCTTAAATATTATGCCATCTTGC
  • ID
    MGI:702906
  • Product Size
    150
  • Other IDs
    D16Mit88 (BROAD)
  • Note
    MIT assay: MT1309
    Additional information: MIT STS Marker Data Files
Genes
D16Mit88 DNA segment, Chr 16, Massachusetts Institute of Technology 88
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D16Mit88 c 157bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D16Mit88 a 116bp SPRET/EiJ
b 149bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
c 157bp C3H/HeJ
d 158bp CAST/EiJ
e 161bp DBA/2J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D16Mit88 a 161bp DBA/2W
b 157bp C3H/W, CBA/W
c 149bp 129/SvW, A.CA/W, AKR/W, BALB/cW, BN/aW, C57BL/6W, C57BL/10W
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D16Mit88 c larger CBA/Kw
e smaller KE
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory