About   Help   FAQ
D12Mit172 Primer Detail
Primers
  • Name
    D12Mit172
  • Primer 1 Sequence
    AACTGAAATCGCATTACAAAACC
  • Primer 2 Sequence
    TAATATTGCGAGTTAGAAATGACCA
  • ID
    MGI:702867
  • Product Size
    200
  • Other IDs
    D12Mit172 (BROAD)
  • Note
    MIT assay: MT2429
    Additional information: MIT STS Marker Data Files
Genes
D12Mit172 DNA segment, Chr 12, Massachusetts Institute of Technology 172
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D12Mit172 c 197bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D12Mit172 a 178bp SPRET/EiJ
b 180bp CAST/EiJ
c 185bp DBA/2J, LP/J, NOD/MrkTac
d 187bp NON/ShiLt
e 197bp A/J, AKR/J, BALB/cJ, C3H/HeJ
f 199bp B6.Cg-Lepob/+, C57BL/6J
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D12Mit172 c larger C58/J
f not given FVB/NJ
i not given I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D12Mit172 c 201bp CBA/CaOlaHsd
s 168bp SWR/OlaHsd
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory