About   Help   FAQ
D4Mit87 Primer Detail
Primers
  • Name
    D4Mit87
  • Primer 1 Sequence
    ACAGGTAGGAATGGAGCCCT
  • Primer 2 Sequence
    TCATCCCTTTGCCAAAGC
  • ID
    MGI:702841
  • Product Size
    114
  • Other IDs
    D4Mit87 (BROAD)
  • Note
    MIT assay: MPC239
    Additional information: MIT STS Marker Data Files
Genes
D4Mit87 DNA segment, Chr 4, Massachusetts Institute of Technology 87
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit87 a 116bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J
b 120bp A/J, AKR/J, BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac, NON/ShiLt
c 122bp SPRET/EiJ
d 126bp CAST/EiJ
J:54496 Rogers MJ, et al., Mamm Genome. 1999 May;10(5):513-9
Endonuclease Gene Allele Fragments Strains
D4Mit87 c 0.13kb CAST/EiJ
p 0.115kb STOCK Whrnwi
w 0.115kb STOCK Whrnwi
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:54496 Rogers MJ, et al., Genetic mapping of the whirler mutation. Mamm Genome. 1999 May;10(5):513-9
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory