About   Help   FAQ
D4Mit82 Primer Detail
Primers
  • Name
    D4Mit82
  • Primer 1 Sequence
    ATGTGTGCCATTTTGCATGT
  • Primer 2 Sequence
    AGTATTGCTTGATAAATTTGCATG
  • ID
    MGI:702838
  • Product Size
    145
  • Other IDs
    D4Mit82 (BROAD)
  • Note
    MIT assay: MPC1003
    Additional information: MIT STS Marker Data Files
Genes
D4Mit82 DNA segment, Chr 4, Massachusetts Institute of Technology 82
Polymorphisms
J:50273 Poltorak A, et al., Blood Cells Mol Dis. 1998 Sep;24(3):340-55
Endonuclease Gene Allele Fragments Strains
D4Mit82 h not given C3H/HeJ
s not given SWR
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit82 a 130bp AKR/J, DBA/2J, NOD/MrkTac
b 140bp CAST/EiJ
c 142bp A/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, LP/J, NON/ShiLt
d 148bp SPRET/EiJ
J:54496 Rogers MJ, et al., Mamm Genome. 1999 May;10(5):513-9
Endonuclease Gene Allele Fragments Strains
D4Mit82 a 0.157kb CBA/Ca
c 0.16kb CAST/EiJ
p 0.147kb STOCK Whrnwi
w 0.135kb STOCK Whrnwi
References
J:50273 Poltorak A, et al., Genetic and physical mapping of the Lps locus: identification of the toll-4 receptor as a candidate gene in the critical region. Blood Cells Mol Dis. 1998 Sep;24(3):340-55
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:54496 Rogers MJ, et al., Genetic mapping of the whirler mutation. Mamm Genome. 1999 May;10(5):513-9
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory