About   Help   FAQ
D4Mit81 Primer Detail
Primers
  • Name
    D4Mit81
  • Primer 1 Sequence
    GACCTGAGTCTTTCTTAAGATGGA
  • Primer 2 Sequence
    GCTTGCTTTTTTGGCTTCTG
  • ID
    MGI:702835
  • Product Size
    160
  • Other IDs
    D4Mit81 (BROAD)
  • Note
    MIT assay: MPC202
    Additional information: MIT STS Marker Data Files
Genes
D4Mit81 DNA segment, Chr 4, Massachusetts Institute of Technology 81
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit81 a 160bp AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
b 186bp SPRET/EiJ
c 196bp CAST/EiJ
d 204bp A/J, BALB/cJ, DBA/2J
J:54496 Rogers MJ, et al., Mamm Genome. 1999 May;10(5):513-9
Endonuclease Gene Allele Fragments Strains
D4Mit81 a 0.17kb CBA/Ca
w 0.24kb STOCK Whrnwi
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D4Mit81 l smaller LG/J
s larger SM/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D4Mit81 a 204bp BALB/cW, DBA/2W
b 160bp 129/SvW, A.CA/W, AKR/W, BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:54496 Rogers MJ, et al., Genetic mapping of the whirler mutation. Mamm Genome. 1999 May;10(5):513-9
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory