About   Help   FAQ
D17Mit29 Primer Detail
Primers
  • Name
    D17Mit29
  • Primer 1 Sequence
    CATCTTTCCAGTCCAAATCTCC
  • Primer 2 Sequence
    CTTCTGGCTTCCTCAACCC
  • ID
    MGI:702824
  • Product Size
    149
  • Other IDs
    D17Mit29 (BROAD)
  • Note
    MIT assay: B238
    Additional information: MIT STS Marker Data Files
Genes
D17Mit29 DNA segment, Chr 17, Massachusetts Institute of Technology 29
Polymorphisms
J:23589 Vernet C, et al., Mamm Genome. 1995 Mar;6(3):219-21
Endonuclease Gene Allele Fragments Strains
D17Mit29 a smallest STOCK t12, STOCK tw5, STOCK tw12
c largest C3H
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit29 a 146bp A/J, AKR/J, C3H/HeJ, CAST/EiJ
b 150bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
References
J:23589 Vernet C, et al., Mapping of 12 markers in the proximal region of mouse chromosome 17 using recombinant t haplotypes. Mamm Genome. 1995 Mar;6(3):219-21
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory