D17Mit28 Primer Detail MGI Mouse MGI:702821

D17Mit28 Primer Detail

Name

D17Mit28
Primer 1 Sequence

ACTCAGGACTCAGAATGAAGATCC
Primer 2 Sequence

ATTCCTAGATGAAAAGTCTGTGGC
ID

MGI:702821
Product Size

121
Other IDs

D17Mit28 (BROAD)
Note

MIT assay: D545
Additional information: MIT STS Marker Data Files

D17Mit28

DNA segment, Chr 17, Massachusetts Institute of Technology 28

J:44833 Meagher S, et al., Hereditas. 1997;127(1-2):75-82

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit28	a	smallest	CAST/EiJ
		b	larger	CBA/J
		c	larger than above	M. caroli
		d	larger than above	DBA/2J
		e	larger than above	A.CA-H2^f/Sn, P/J
		f	larger than above	SJL/J
		g	larger than above	RIIIS/J
		h	larger than above	M. spretus, SM/J
		i	larger than above	SWR/J
		j	larger than above	C57BL/6J

J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4

Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit28	c	104bp	BALB/cJ
Not Specified	D17Mit28	s	120bp	129X1/SvJ, C57BL/6J

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit28	a	86bp	CAST/EiJ
	b	96bp	A/J, C3H/HeJ
	c	98bp	AKR/J
	d	104bp	BALB/cJ, DBA/2J, NOD/MrkTac
	e	114bp	SPRET/EiJ
	f	118bp	NON/ShiLt
	g	120bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit28	l	smaller	LG/J
	D17Mit28	s	larger	SM/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D17Mit28	a	120bp	129/SvW, C57BL/6W, C57BL/10W
	b	114bp	BN/aW
	c	108bp	A.CA/W
	d	104bp	BALB/cW, DBA/2W
	e	92bp	AKR/W, C3H/W, CBA/W

J:44833 Meagher S, et al., A microsatellite-based MHC genotyping system for house mice (Mus domesticus). Hereditas. 1997;127(1-2):75-82

J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/23/2024 MGI 6.23