About   Help   FAQ
D17Mit28 Primer Detail
Primers
  • Name
    D17Mit28
  • Primer 1 Sequence
    ACTCAGGACTCAGAATGAAGATCC
  • Primer 2 Sequence
    ATTCCTAGATGAAAAGTCTGTGGC
  • ID
    MGI:702821
  • Product Size
    121
  • Other IDs
    D17Mit28 (BROAD)
  • Note
    MIT assay: D545
    Additional information: MIT STS Marker Data Files
Genes
D17Mit28 DNA segment, Chr 17, Massachusetts Institute of Technology 28
Polymorphisms
J:44833 Meagher S, et al., Hereditas. 1997;127(1-2):75-82
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit28 a smallest CAST/EiJ
b larger CBA/J
c larger than above M. caroli
d larger than above DBA/2J
e larger than above A.CA-H2f/Sn, P/J
f larger than above SJL/J
g larger than above RIIIS/J
h larger than above M. spretus, SM/J
i larger than above SWR/J
j larger than above C57BL/6J
J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4
Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit28 c 104bp BALB/cJ
s 120bp 129X1/SvJ, C57BL/6J
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit28 a 86bp CAST/EiJ
b 96bp A/J, C3H/HeJ
c 98bp AKR/J
d 104bp BALB/cJ, DBA/2J, NOD/MrkTac
e 114bp SPRET/EiJ
f 118bp NON/ShiLt
g 120bp B6.Cg-Lepob/+, C57BL/6J, LP/J
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D17Mit28 l smaller LG/J
s larger SM/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D17Mit28 a 120bp 129/SvW, C57BL/6W, C57BL/10W
b 114bp BN/aW
c 108bp A.CA/W
d 104bp BALB/cW, DBA/2W
e 92bp AKR/W, C3H/W, CBA/W
References
J:44833 Meagher S, et al., A microsatellite-based MHC genotyping system for house mice (Mus domesticus). Hereditas. 1997;127(1-2):75-82
J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory