About   Help   FAQ
D17Mit24 Primer Detail
Primers
  • Name
    D17Mit24
  • Primer 1 Sequence
    ACCTCTCACCTCTCTCTGTG
  • Primer 2 Sequence
    TGGAGAGACGTCCTATGATG
  • ID
    MGI:702813
  • Product Size
    131
  • Other IDs
    D17Mit24 (BROAD)
  • Note
    MIT assay: D12
    Additional information: MIT STS Marker Data Files
Genes
D17Mit24 DNA segment, Chr 17, Massachusetts Institute of Technology 24
Polymorphisms
J:44833 Meagher S, et al., Hereditas. 1997;127(1-2):75-82
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit24 a smallest M. spretus, P/J
b larger DBA/2J
c larger than above CAST/EiJ
d larger than above A.CA-H2f/Sn
e larger than above CBA/J
f larger than above C57BL/6J, SM/J, SWR/J
g larger than above RIIIS/J
h larger than above SJL/J
i larger than above M. caroli
J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4
Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit24 b 142bp C57BL/6J
s 126bp 129X1/SvJ, BALB/cJ
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit24 m 144bp MOLF/EiJ
s 160bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit24 a 117bp SPRET/EiJ
b 126bp BALB/cJ, DBA/2J, LP/J
c 137bp CAST/EiJ
d 142bp A/J, B6.Cg-Lepob/+, C57BL/6J, NOD/MrkTac, NON/ShiLt
e 144bp AKR/J, C3H/HeJ
J:66472 Matsune K, J Oral Sci. 2000 Mar;42(1):21-6
Endonuclease Gene Allele Fragments Strains
D17Mit24 b larger C57BL/6J
l smaller C57L/J
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D17Mit24 l larger LG/J
s smaller SM/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D17Mit24 a 142bp AKR/W, C3H/W, C57BL/6W, C57BL/10W, CBA/W
b 130bp A.CA/W
c 126bp 129/SvW, BALB/cW, BN/aW, DBA/2W
References
J:44833 Meagher S, et al., A microsatellite-based MHC genotyping system for house mice (Mus domesticus). Hereditas. 1997;127(1-2):75-82
J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:66472 Matsune K, Molecular genetic study of the gutter shaped root (GSR) on mouse chromosome 17. J Oral Sci. 2000 Mar;42(1):21-6
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/05/2026
MGI 6.24
The Jackson Laboratory