About   Help   FAQ
D8Mit12 Primer Detail
Primers
  • Name
    D8Mit12
  • Primer 1 Sequence
    GATCTCTACATCAAAAGGGA
  • Primer 2 Sequence
    TTCAGTTTTGTTTCTGAAAC
  • ID
    MGI:702808
  • Product Size
    119
  • Other IDs
    D8Mit12 (BROAD)
  • Note
    MIT assay: L11
    Additional information: MIT STS Marker Data Files
Genes
D8Mit12 DNA segment, Chr 8, Massachusetts Institute of Technology 12
Polymorphisms
J:38923 Becker-Follmann J, et al., Mamm Genome. 1997 Mar;8(3):172-7
Endonuclease Gene Allele Fragments Strains
Not Specified D8Mit12 d 0.125kb DS8, M. spretus
m 0.129kb M. m. molossinus
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D8Mit12 m 126bp MOLF/EiJ
s 130bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit12 a 115bp NOD/MrkTac
b 118bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NON/ShiLt
c 124bp SPRET/EiJ
d 126bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D8Mit12 c 106bp CBA/CaOlaHsd
s 106bp SWR/OlaHsd
References
J:38923 Becker-Follmann J, et al., High-resolution mapping of a linkage group on mouse chromosome 8 conserved on human chromosome 16Q. Mamm Genome. 1997 Mar;8(3):172-7
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory