About   Help   FAQ
D12Mit190 Primer Detail
Primers
  • Name
    D12Mit190
  • Primer 1 Sequence
    CCCTTGCTATCTTTCAAACCC
  • Primer 2 Sequence
    TCATAGCAGGTTTATAGGATGTGTG
  • ID
    MGI:702803
  • Product Size
    125
  • Other IDs
    D12Mit190 (BROAD)
  • Note
    MIT assay: MT3402
    Additional information: MIT STS Marker Data Files
Genes
D12Mit190 DNA segment, Chr 12, Massachusetts Institute of Technology 190
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D12Mit190 a 114bp DBA/2J, NOD/MrkTac
b 118bp NON/ShiLt
c 128bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, LP/J
d 138bp SPRET/EiJ
e 140bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D12Mit190 c 125bp CBA/CaOlaHsd
s 105bp SWR/OlaHsd
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D12Mit190 a smaller 129P3/J
s larger SJL/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory