About   Help   FAQ
D12Mit194 Primer Detail
Primers
  • Name
    D12Mit194
  • Primer 1 Sequence
    TTCCGCTATCCTCAAGTTGG
  • Primer 2 Sequence
    GTTGACCTCCTTGAGTTGCTG
  • ID
    MGI:702799
  • Product Size
    108
  • Other IDs
    D12Mit194 (BROAD)
  • Note
    MIT assay: MTAR179
    Additional information: MIT STS Marker Data Files
Genes
D12Mit194 DNA segment, Chr 12, Massachusetts Institute of Technology 194
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D12Mit194 a 100bp 129P2/Ola, 129P3/J, 129T1/Sv-Dnd1Ter, 129X1/Sv
b 108bp 129X1/SvJ
c 100, 108bp CD-1
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D12Mit194 c 100bp C3HeB/FeJLe
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D12Mit194 a 98bp CAST/EiJ
b 100bp A/J, C3H/HeJ, DBA/2J
c 108bp AKR/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, LP/J, NON/ShiLt
d 112bp NOD/MrkTac
e 120bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D12Mit194 c 107bp CBA/CaOlaHsd
s 119bp SWR/OlaHsd
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D12Mit194 a 120bp BN/aW
b 108bp AKR/W, BALB/cW, C57BL/6W, C57BL/10W, CBA/W
c 100bp 129/SvW, A.CA/W, C3H/W, DBA/2W
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory