About   Help   FAQ
DXMit89 Primer Detail
Primers
  • Name
    DXMit89
  • Primer 1 Sequence
    TTCAGTTTTCCCTTCCCATG
  • Primer 2 Sequence
    AGGGAGTTACTGGGAGGGG
  • ID
    MGI:702792
  • Product Size
    146
  • Other IDs
    DXMit89 (BROAD)
  • Note
    MIT assay: MT747
    Additional information: MIT STS Marker Data Files
Genes
DXMit89 DNA segment, Chr X, Massachusetts Institute of Technology 89
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified DXMit89 a 149bp 129X1/Sv
Not Specified DXMit89 f 147bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit89 a 137bp SPRET/EiJ
b 147bp CAST/EiJ
c 149bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
d 157bp C3H/HeJ, DBA/2J, LP/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
DXMit89 a 157bp 129/SvW, C3H/W, DBA/2W
b 149bp A.CA/W, AKR/W, BALB/cW, BN/aW, C57BL/6W, C57BL/10W, CBA/W
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory