About   Help   FAQ
D11Mit271 Primer Detail
Primers
  • Name
    D11Mit271
  • Primer 1 Sequence
    TCTCCACACATTCACCATGG
  • Primer 2 Sequence
    CTTCCTCAATTGCTCTTGCC
  • ID
    MGI:702780
  • Product Size
    120
  • Other IDs
    D11Mit271 (BROAD)
  • Note
    MIT assay: MT4388
    Additional information: MIT STS Marker Data Files
Genes
D11Mit271 DNA segment, Chr 11, Massachusetts Institute of Technology 271
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D11Mit271 a 116bp 129X1/Sv
f 118bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit271 a 106bp SPRET/EiJ
b 116bp A/J, BALB/cJ, C3H/HeJ, LP/J
c 120bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J, NON/ShiLt
d 123bp AKR/J, NOD/MrkTac
e 134bp CAST/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D11Mit271 a 123bp AKR/OlaHsd, SJL/J
c 115bp 129P3/J, A/JOlaHsd, BALB/cJ, C3H/HeJ, JF1
d 121bp C57BL/6JOlaHsd, DBA/2J
p 117bp PWB
r 119bp C57BL/10
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory