D11Mit270 Primer Detail MGI Mouse MGI:702779

D11Mit270 Primer Detail

Name

D11Mit270
Primer 1 Sequence

AGTCAAGCAGGAGATCTTAAAATATG
Primer 2 Sequence

TGAGTGTGTTCTTGCATCAGTG
ID

MGI:702779
Product Size

125
Other IDs

D11Mit270 (BROAD)
Note

MIT assay: MT4579
Additional information: MIT STS Marker Data Files

DNA segment, Chr 11, Massachusetts Institute of Technology 270

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D11Mit270	a	121bp	129X1/Sv
Not Specified	D11Mit270	f	113, 123bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit270	a	105bp	CAST/EiJ, SPRET/EiJ
	b	113bp	A/J, C3H/HeJ, LP/J
	c	121bp	AKR/J, DBA/2J, NOD/MrkTac
	d	125bp	B6.Cg-Lep^ob/+, C57BL/6J
	e	129bp	NON/ShiLt

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24