About   Help   FAQ
D11Mit270 Primer Detail
Primers
  • Name
    D11Mit270
  • Primer 1 Sequence
    AGTCAAGCAGGAGATCTTAAAATATG
  • Primer 2 Sequence
    TGAGTGTGTTCTTGCATCAGTG
  • ID
    MGI:702779
  • Product Size
    125
  • Other IDs
    D11Mit270 (BROAD)
  • Note
    MIT assay: MT4579
    Additional information: MIT STS Marker Data Files
Genes
D11Mit270 DNA segment, Chr 11, Massachusetts Institute of Technology 270
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D11Mit270 a 121bp 129X1/Sv
f 113, 123bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit270 a 105bp CAST/EiJ, SPRET/EiJ
b 113bp A/J, C3H/HeJ, LP/J
c 121bp AKR/J, DBA/2J, NOD/MrkTac
d 125bp B6.Cg-Lepob/+, C57BL/6J
e 129bp NON/ShiLt
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory