About   Help   FAQ
DXMit80 Primer Detail
Primers
  • Name
    DXMit80
  • Primer 1 Sequence
    AGGTTGCAATCATCTGGAGG
  • Primer 2 Sequence
    CCATTGGTCCAAGCAAGC
  • ID
    MGI:702773
  • Product Size
    141
  • Other IDs
    DXMit80 (BROAD)
  • Note
    MIT assay: MT590
    Additional information: MIT STS Marker Data Files
Genes
DXMit80 DNA segment, Chr X, Massachusetts Institute of Technology 80
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit80 a 123bp CAST/EiJ
b 137bp SPRET/EiJ
c 141bp AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NON/ShiLt
d 145bp A/J, BALB/cJ, NOD/MrkTac
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
DXMit80 c 146bp A/JOlaHsd, BALB/cJ
d 142bp 129P3/J, AKR/OlaHsd, C3H/HeJ, C57BL/6JOlaHsd, DBA/2J, PWB, SJL/J
j 152bp JF1
r 138bp C57BL/10
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory