About   Help   FAQ
D17Mit22 Primer Detail
Primers
  • Name
    D17Mit22
  • Primer 1 Sequence
    GGTAAGCATTAGATAGAGAG
  • Primer 2 Sequence
    TTATGATCTCCACACACGTG
  • ID
    MGI:702762
  • Product Size
    189
  • Other IDs
    D17Mit22 (BROAD)
  • Note
    MIT assay: D16
    Additional information: MIT STS Marker Data Files
Genes
D17Mit22 DNA segment, Chr 17, Massachusetts Institute of Technology 22
Polymorphisms
J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit22 b 0.157kb B10.BR-H2k, BALB.K-H2k, C57BL/6
c 0.183kb B10.D2-H2d, BALB/cAnNCr, BALB/cByJ, BALB/cJ
J:44833 Meagher S, et al., Hereditas. 1997;127(1-2):75-82
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit22 a smallest SWR/J
b larger SJL/J
c larger than above C57BL/6J, CBA/J
d larger than above A.CA-H2f/Sn, M. spretus
e larger than above P/J, SM/J
f larger than above RIIIS/J
g larger than above CAST/EiJ
h larger than above M. caroli
i larger than above DBA/2J
J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4
Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit22 c 183bp BALB/cJ
s 157bp 129X1/SvJ, C57BL/6J
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit22 a 155bp LP/J
b 157bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, NOD/MrkTac
c 159bp A/J, C3H/HeJ
d 162bp SPRET/EiJ
e 176bp CAST/EiJ
f 183bp BALB/cJ, DBA/2J
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D17Mit22 l larger LG/J
s smaller SM/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D17Mit22 a 183bp BALB/cW, DBA/2W
b 157bp 129/SvW, A.CA/W, AKR/W, C3H/W, C57BL/6W, C57BL/10W, CBA/W
c 153bp BN/aW
References
J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61
J:44833 Meagher S, et al., A microsatellite-based MHC genotyping system for house mice (Mus domesticus). Hereditas. 1997;127(1-2):75-82
J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory