About   Help   FAQ
D17Mit21 Primer Detail
Primers
  • Name
    D17Mit21
  • Primer 1 Sequence
    TAACACCAGACATTGACCTC
  • Primer 2 Sequence
    AGTCTAGATATGTGTCTCCC
  • ID
    MGI:702761
  • Product Size
    138
  • Other IDs
    D17Mit21 (BROAD)
  • Note
    MIT assay: D21
    Additional information: MIT STS Marker Data Files
Genes
D17Mit21 DNA segment, Chr 17, Massachusetts Institute of Technology 21
Polymorphisms
J:44833 Meagher S, et al., Hereditas. 1997;127(1-2):75-82
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit21 a smallest M. caroli
b larger A.CA-H2f/Sn, CAST/EiJ
c larger than above SWR/J
d larger than above P/J, RIIIS/J
e larger than above CBA/J
f larger than above SJL/J
g larger than above SM/J
h larger than above C57BL/6J, M. spretus
i larger than above DBA/2J
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit21 a 105bp CAST/EiJ
b 122bp A/J, AKR/J, C3H/HeJ, NOD/MrkTac
c 123bp NON/ShiLt
d 134bp LP/J
e 137bp B6.Cg-Lepob/+, C57BL/6J, SPRET/EiJ
f 154bp BALB/cJ, DBA/2J
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D17Mit21 l larger LG/J
s smaller SM/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D17Mit21 c 123bp CBA/CaOlaHsd
s 108bp SWR/OlaHsd
References
J:44833 Meagher S, et al., A microsatellite-based MHC genotyping system for house mice (Mus domesticus). Hereditas. 1997;127(1-2):75-82
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/14/2024
MGI 6.23
The Jackson Laboratory