About   Help   FAQ
D4Mit104 Primer Detail
Primers
  • Name
    D4Mit104
  • Primer 1 Sequence
    CATTCTTCTTGGTCACATTTTCC
  • Primer 2 Sequence
    TATGTATTGATCAGGGGAACACA
  • ID
    MGI:702712
  • Product Size
    242
  • Other IDs
    D4Mit104 (BROAD)
  • Note
    MIT assay: MPC2215
    Additional information: MIT STS Marker Data Files
Genes
D4Mit104 DNA segment, Chr 4, Massachusetts Institute of Technology 104
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit104 a 235bp A/J
b 237bp NOD/MrkTac
c 241bp AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NON/ShiLt
d 243bp B6.Cg-Lepob/+, C57BL/6J
e 275bp CAST/EiJ
f 277bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D4Mit104 c 152bp CBA/CaOlaHsd
s 156bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory