About   Help   FAQ
D15Mit105 Primer Detail
Primers
  • Name
    D15Mit105
  • Primer 1 Sequence
    ACTGGCTTATCTAGCATTCTCCC
  • Primer 2 Sequence
    CATATTGTCTTATCAGCCATGTCC
  • ID
    MGI:702707
  • Product Size
    122
  • Other IDs
    D15Mit105 (BROAD)
  • Note
    MIT assay: MT740
    Additional information: MIT STS Marker Data Files
Genes
D15Mit105 DNA segment, Chr 15, Massachusetts Institute of Technology 105
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit105 a 113bp DBA/2J
b 125bp B6.Cg-Lepob/+, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
c 126bp SPRET/EiJ
d 127bp AKR/J
e 131bp A/J, BALB/cJ, C3H/HeJ
f 132bp CAST/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D15Mit105 a 122bp AKR/OlaHsd
b 120bp 129P3/J, C57BL/6JOlaHsd, C57BL/10, SJL/J
c 126bp A/JOlaHsd, BALB/cJ
d 108bp DBA/2J
j 106bp JF1
p 128bp C3H/HeJ, PWB
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D15Mit105 c 145bp CBA/CaOlaHsd
s 143bp SWR/OlaHsd
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D15Mit105 c larger CBA/Kw
e smaller KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory