About   Help   FAQ
D5Mit424 Primer Detail
Primers
  • Name
    D5Mit424
  • Primer 1 Sequence
    GACTCCTCCTCGCCTTTCTT
  • Primer 2 Sequence
    AAAATTACATTTGCATCTGGGG
  • ID
    MGI:702702
  • Product Size
    133
  • Other IDs
    D5Mit424 (BROAD)
  • Note
    MIT assay: MT3586
    Additional information: MIT STS Marker Data Files
Genes
D5Mit424 DNA Segment, Chr 5, Massachusetts Institute of Technology 424
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit424 a 124bp A/J, LP/J
b 126bp BALB/cJ, DBA/2J
c 128bp CAST/EiJ
d 130bp NOD/MrkTac
e 132bp B6.Cg-Lepob/+, C57BL/6J
f 134bp AKR/J, C3H/HeJ, NON/ShiLt
g 144bp SPRET/EiJ
J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;
Endonuclease Gene Allele Fragments Strains
D5Mit424 c lower CBA/Kw
e upper KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory