About   Help   FAQ
D5Mit259 Primer Detail
Primers
  • Name
    D5Mit259
  • Primer 1 Sequence
    ATGATCAAAACATTACTCCCTTCC
  • Primer 2 Sequence
    ACAAAGTCAGGAGAAATGTGCA
  • ID
    MGI:702688
  • Product Size
    130
  • Other IDs
    D5Mit259 (BROAD)
  • Note
    MIT assay: MT3428
    Additional information: MIT STS Marker Data Files
Genes
D5Mit259 DNA segment, Chr 5, Massachusetts Institute of Technology 259
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit259 a 112bp SPRET/EiJ
b 120bp LP/J
c 134bp CAST/EiJ
d 140bp A/J, AKR/J, B6.Cg-Lepob/+, C57BL/6J
e 146bp BALB/cJ, C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D5Mit259 c not given C58/J
f not given FVB/NJ
i larger I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D5Mit259 c 276bp CBA/CaOlaHsd
s 275bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory