About   Help   FAQ
D3Mit14 Primer Detail
Primers
  • Name
    D3Mit14
  • Primer 1 Sequence
    ATTGCGGTTAAAGTTTGCTT
  • Primer 2 Sequence
    TCCTGCAAATTGTCCTCTGA
  • ID
    MGI:702683
  • Product Size
    168
  • Other IDs
    D3Mit14 (BROAD)
  • Note
    MIT assay: M206
    Additional information: MIT STS Marker Data Files
Genes
D3Mit14 DNA segment, Chr 3, Massachusetts Institute of Technology 14
Polymorphisms
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D3Mit14 a largest DBA/2
b smaller C57BL/6
c smallest JF1, MSM/Ms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit14 a 127bp CAST/EiJ
b 132bp SPRET/EiJ
c 170bp B6.Cg-Lepob/+, C57BL/6J, LP/J
d 198bp A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt
References
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory