D9Mit104 Primer Detail MGI Mouse MGI:702682

D9Mit104 Primer Detail

Name

D9Mit104
Primer 1 Sequence

TTAATTGAGACGCACTTTGGG
Primer 2 Sequence

AGGGGTCATTAGAGTTGGGG
ID

MGI:702682
Product Size

125
Other IDs

D9Mit104 (BROAD)
Note

MIT assay: MMH253
Additional information: MIT STS Marker Data Files

D9Mit104

DNA segment, Chr 9, Massachusetts Institute of Technology 104

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D9Mit104	a	117bp	A/J, BALB/cJ, C3H/HeJ, NON/ShiLt
	b	121bp	CAST/EiJ, LP/J, NOD/MrkTac
	c	125bp	B6.Cg-Lep^ob/+, C57BL/6J
	d	129bp	DBA/2J
	e	149bp	SPRET/EiJ

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit104	c	upper	CBA/Kw
	D9Mit104	e	lower	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/21/2024 MGI 6.23