D6Mit149 Primer Detail MGI Mouse MGI:702667

D6Mit149 Primer Detail

Name

D6Mit149
Primer 1 Sequence

ACATGCATGCACAACTCCAT
Primer 2 Sequence

TTTTTTGTGGGCTGCATGTA
ID

MGI:702667
Product Size

199
Other IDs

D6Mit149 (BROAD)
Note

MIT assay: MT1073
Additional information: MIT STS Marker Data Files

D6Mit149

DNA segment, Chr 6, Massachusetts Institute of Technology 149

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D6Mit149	c	215bp	C3HeB/FeJLe
	D6Mit149	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D6Mit149	a	189bp	B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac
	b	191bp	LP/J
	c	199bp	DBA/2J
	d	215bp	A/J, BALB/cJ, C3H/HeJ, NON/ShiLt
	e	217bp	AKR/J
	f	235bp	CAST/EiJ
	g	309bp	SPRET/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D6Mit149	c	98bp	CBA/CaOlaHsd
	D6Mit149	s	103bp	SWR/OlaHsd

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24