D4Mit325 Primer Detail MGI Mouse MGI:702655

D4Mit325 Primer Detail

Name

D4Mit325
Primer 1 Sequence

GTTCCGTTTCTTTTTACAACTATGG
Primer 2 Sequence

ATTTGCCTATTTTATTTTCATTTGTG
ID

MGI:702655
Product Size

108
Other IDs

D4Mit325 (BROAD)
Note

MIT assay: MTH2951
Additional information: MIT STS Marker Data Files

D4Mit325

DNA segment, Chr 4, Massachusetts Institute of Technology 325

J:50273 Poltorak A, et al., Blood Cells Mol Dis. 1998 Sep;24(3):340-55

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit325	h	not given	C3H/HeJ
	D4Mit325	s	not given	SWR

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit325	a	108bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, LP/J, NON/ShiLt
	b	110bp	AKR/J, DBA/2J, NOD/MrkTac
	c	112bp	SPRET/EiJ

J:50273 Poltorak A, et al., Genetic and physical mapping of the Lps locus: identification of the toll-4 receptor as a candidate gene in the critical region. Blood Cells Mol Dis. 1998 Sep;24(3):340-55

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/21/2024 MGI 6.23