About   Help   FAQ
D4Mit325 Primer Detail
Primers
  • Name
    D4Mit325
  • Primer 1 Sequence
    GTTCCGTTTCTTTTTACAACTATGG
  • Primer 2 Sequence
    ATTTGCCTATTTTATTTTCATTTGTG
  • ID
    MGI:702655
  • Product Size
    108
  • Other IDs
    D4Mit325 (BROAD)
  • Note
    MIT assay: MTH2951
    Additional information: MIT STS Marker Data Files
Genes
D4Mit325 DNA segment, Chr 4, Massachusetts Institute of Technology 325
Polymorphisms
J:50273 Poltorak A, et al., Blood Cells Mol Dis. 1998 Sep;24(3):340-55
Endonuclease Gene Allele Fragments Strains
D4Mit325 h not given C3H/HeJ
s not given SWR
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit325 a 108bp A/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, LP/J, NON/ShiLt
b 110bp AKR/J, DBA/2J, NOD/MrkTac
c 112bp SPRET/EiJ
References
J:50273 Poltorak A, et al., Genetic and physical mapping of the Lps locus: identification of the toll-4 receptor as a candidate gene in the critical region. Blood Cells Mol Dis. 1998 Sep;24(3):340-55
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory