D12Mit8 Primer Detail MGI Mouse MGI:702637

D12Mit8 Primer Detail

Name

D12Mit8
Primer 1 Sequence

TTGCCTAACCCACTCACACC
Primer 2 Sequence

TGGTGACTCCTTACAGAGGC
ID

MGI:702637
Product Size

175
Other IDs

D12Mit8 (BROAD)
Note

MIT assay: D7
Additional information: MIT STS Marker Data Files

D12Mit8

DNA segment, Chr 12, Massachusetts Institute of Technology 8

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D12Mit8	m	281bp	MOLF/EiJ
Not Specified	D12Mit8	s	270bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit8	a	146bp	A/J, SPRET/EiJ
	b	165bp	LP/J, NOD/MrkTac
	c	168bp	B6.Cg-Lep^ob/+, C57BL/6J
	d	170bp	BALB/cJ, C3H/HeJ, NON/ShiLt
	e	178bp	CAST/EiJ
	f	179bp	DBA/2J
	g	181bp	AKR/J

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit8	l	larger	LG/J
	D12Mit8	s	smaller	SM/J

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24