About   Help   FAQ
D10Mit183 Primer Detail
Primers
  • Name
    D10Mit183
  • Primer 1 Sequence
    GGTGCCATGGGTAGACATG
  • Primer 2 Sequence
    CCCCTTTAAGAAAGGAAGTAGTCC
  • ID
    MGI:702624
  • Product Size
    139
  • Other IDs
    D10Mit183 (BROAD)
  • Note
    MIT assay: MT3341
    Additional information: MIT STS Marker Data Files
Genes
D10Mit183a DNA segment, Chr 10, Massachusetts Institute of Technology 183a
D10Mit183b DNA segment, Chr 10, Massachusetts Institute of Technology 183b
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit183a a 140bp NON/ShiLt
b 144bp A/J, BALB/cJ, LP/J, NOD/MrkTac
c 152bp B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J
d 158bp AKR/J
e 170bp CAST/EiJ
f 174bp SPRET/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D10Mit183a c 136bp A/JOlaHsd, BALB/cJ, SJL/J
d 134bp AKR/OlaHsd, C3H/HeJ, C57BL/6JOlaHsd, C57BL/10, DBA/2J
p 156bp 129P3/J, JF1, PWB
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D10Mit183a c 148bp CBA/CaOlaHsd
s 145bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory