D7Mit1 Primer Detail MGI Mouse MGI:702615

D7Mit1 Primer Detail

Name

D7Mit1
Primer 1 Sequence

GTCCCAGTGTGTATATATAATCCAG
Primer 2 Sequence

GGATTATACACACAGATGTTGGG
ID

MGI:702615
Product Size

296
Note

MIT assay: M208

D7Mit1

DNA segment, Chr 7, Massachusetts Institute of Technology 1

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D7Mit1	m	307bp	MOLF/EiJ
Not Specified	D7Mit1	s	287bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D7Mit1	a	298bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NON/ShiLt, SPRET/EiJ
	b	301bp	NOD/MrkTac
	c	309bp	CAST/EiJ

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 03/25/2025 MGI 6.24