D7Mit8 Primer Detail MGI Mouse MGI:702608

D7Mit8 Primer Detail

Name

D7Mit8
Primer 1 Sequence

TTGGCCTTTATAGGCACCTG
Primer 2 Sequence

TAAGGCACCATGATATGGCA
ID

MGI:702608
Product Size

149
Other IDs

D7Mit8 (BROAD)
Note

MIT assay: M183
Additional information: MIT STS Marker Data Files

D7Mit8

DNA segment, Chr 7, Massachusetts Institute of Technology 8

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D7Mit8	a	largest	C57BL/6, DBA/2
Not Specified	D7Mit8	b	smaller	JF1, MSM/Ms

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D7Mit8	a	150bp	B6.Cg-Lep^ob/+, C57BL/6J
	b	151bp	A/J
	c	153bp	CAST/EiJ
	d	165bp	SPRET/EiJ

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23