About   Help   FAQ
D8Mit190 Primer Detail
Primers
  • Name
    D8Mit190
  • Primer 1 Sequence
    CTTTGTTGCTGTTTCATTCTGG
  • Primer 2 Sequence
    AGTCATATACAAGGTCAACCTGAGC
  • ID
    MGI:702601
  • Product Size
    133
  • Other IDs
    D8Mit190 (BROAD)
  • Note
    MIT assay: MT2951
    Additional information: MIT STS Marker Data Files
Genes
D8Mit190 DNA segment, Chr 8, Massachusetts Institute of Technology 190
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D8Mit190 b larger C57BL/6J
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit190 a 98bp A/J, AKR/J, BALB/cJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt, SPRET/EiJ
b 116bp C3H/HeJ
c 122bp CAST/EiJ
d 138bp B6.Cg-Lepob/+, C57BL/6J
J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;
Endonuclease Gene Allele Fragments Strains
D8Mit190 c lower CBA/Kw
e upper KE
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory