About   Help   FAQ
D5Mit101 Primer Detail
Primers
  • Name
    D5Mit101
  • Primer 1 Sequence
    GGGATGACGTTTGAGGTTGT
  • Primer 2 Sequence
    CTGCTTGGGATGTGGGTC
  • ID
    MGI:702580
  • Product Size
    132
  • Other IDs
    D5Mit101 (BROAD)
  • Note
    MIT assay: MPC839
    Additional information: MIT STS Marker Data Files
Genes
D5Mit101 DNA segment, Chr 5, Massachusetts Institute of Technology 101
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D5Mit101 a 130bp 129X1/Sv
f 118, 130bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit101 a 118bp A/J, BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac
b 130bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J, NON/ShiLt
c 134bp AKR/J
d 138bp CAST/EiJ
e 154bp SPRET/EiJ
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory