D8Mit25 Primer Detail MGI Mouse MGI:702564

D8Mit25 Primer Detail

Name

D8Mit25
Primer 1 Sequence

TCAGACTAATGTCCAGTAGCAAGC
Primer 2 Sequence

ATTGCATGTCCATGTCTGGA
ID

MGI:702564
Product Size

118
Other IDs

D8Mit25 (BROAD)
Note

MIT assay: A780
Additional information: MIT STS Marker Data Files

D8Mit25

DNA segment, Chr 8, Massachusetts Institute of Technology 25

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D8Mit25	c	130bp	C3HeB/FeJLe
	D8Mit25	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D8Mit25	a	108bp	SPRET/EiJ
	b	120bp	B6.Cg-Lep^ob/+, C57BL/6J
	c	126bp	A/J, NOD/MrkTac, NON/ShiLt
	d	130bp	AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J
	e	132bp	CAST/EiJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D8Mit25	l	larger	LG/J
	D8Mit25	s	smaller	SM/J

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D8Mit25	c	116bp	CBA/CaOlaHsd
	D8Mit25	s	118bp	SWR/OlaHsd

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/30/2025 MGI 6.24