About   Help   FAQ
D16Mit154 Primer Detail
Primers
  • Name
    D16Mit154
  • Primer 1 Sequence
    AAATCAATCCCAGAGAAACAGG
  • Primer 2 Sequence
    TCTTGTGTGTGTGTGCATGC
  • ID
    MGI:702507
  • Product Size
    144
  • Other IDs
    D16Mit154 (BROAD)
  • Note
    MIT assay: MT2848
    Additional information: MIT STS Marker Data Files
Genes
D16Mit154 DNA segment, Chr 16, Massachusetts Institute of Technology 154
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D16Mit154 c 116bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D16Mit154 a 116bp C3H/HeJ, DBA/2J, LP/J, NON/ShiLt
b 123bp BALB/cJ
c 125bp A/J, AKR/J, NOD/MrkTac
d 128bp SPRET/EiJ
e 140bp CAST/EiJ
f 146bp B6.Cg-Lepob/+, C57BL/6J
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D16Mit154 c larger C58/J
f not given FVB/NJ
i not given I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D16Mit154 c 159bp CBA/CaOlaHsd
s 162bp SWR/OlaHsd
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory