About   Help   FAQ
D16Mit158 Primer Detail
Primers
  • Name
    D16Mit158
  • Primer 1 Sequence
    AAGAAGGTGGTGGTTGCTGT
  • Primer 2 Sequence
    ACTATCCACACCCATCTTAAGAGC
  • ID
    MGI:702505
  • Product Size
    137
  • Other IDs
    D16Mit158 (BROAD)
  • Note
    MIT assay: MT3616
    Additional information: MIT STS Marker Data Files
Genes
D16Mit158 DNA segment, Chr 16, Massachusetts Institute of Technology 158
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D16Mit158 a 156bp 129X1/Sv
f 140, 156bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D16Mit158 a 140bp AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J
b 154bp DBA/2J
c 156bp A/J, CAST/EiJ, LP/J, NOD/MrkTac, NON/ShiLt
d 164bp SPRET/EiJ
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory