D15Mit63 Primer Detail MGI Mouse MGI:702475

D15Mit63 Primer Detail

Name

D15Mit63
Primer 1 Sequence

ACCAATGATCGTTGATGCCT
Primer 2 Sequence

TAATTTCACACTAGCAAAACCAAA
ID

MGI:702475
Product Size

145
Other IDs

D15Mit63 (BROAD)
Note

MIT assay: MPC2035
Additional information: MIT STS Marker Data Files

D15Mit63

DNA segment, Chr 15, Massachusetts Institute of Technology 63

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D15Mit63	c	124bp	C3HeB/FeJLe
	D15Mit63	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D15Mit63	a	124bp	BALB/cJ, C3H/HeJ
	b	126bp	SPRET/EiJ
	c	134bp	DBA/2J
	d	138bp	A/J, AKR/J
	e	146bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
	f	158bp	CAST/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D15Mit63	c	146bp	CBA/CaOlaHsd
	D15Mit63	s	143bp	SWR/OlaHsd

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D15Mit63	c	smaller	CBA/Kw
	D15Mit63	e	larger	KE

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/09/2025 MGI 6.24