About   Help   FAQ
D15Mit66 Primer Detail
Primers
  • Name
    D15Mit66
  • Primer 1 Sequence
    TACACTCATTCATCTGGAAGAGTC
  • Primer 2 Sequence
    TGGGTGCAGATTGAGATGAG
  • ID
    MGI:702470
  • Product Size
    151
  • Other IDs
    D15Mit66 (BROAD)
  • Note
    MIT assay: MPC331
    Additional information: MIT STS Marker Data Files
Genes
D15Mit66 DNA segment, Chr 15, Massachusetts Institute of Technology 66
Polymorphisms
J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61
Endonuclease Gene Allele Fragments Strains
Not Specified D15Mit66 b 0.152kb C57BL/6
c 0.146kb B10.BR-H2k, BALB.K-H2k, BALB/cAnNCr, BALB/cByJ, BALB/cJ
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit66 a 146bp BALB/cJ, C3H/HeJ
b 148bp AKR/J, DBA/2J, LP/J, NON/ShiLt
c 150bp NOD/MrkTac
d 152bp A/J, B6.Cg-Lepob/+, C57BL/6J
e 160bp CAST/EiJ
References
J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory