About   Help   FAQ
D1Mit30 Primer Detail
Primers
  • Name
    D1Mit30
  • Primer 1 Sequence
    TGAACCATCACCATGCTGTT
  • Primer 2 Sequence
    TGGGCTGCGTTTCTAAGG
  • ID
    MGI:702469
  • Product Size
    101
  • Other IDs
    D1Mit30 (BROAD)
  • Note
    MIT assay: P100
    Additional information: MIT STS Marker Data Files
Genes
D1Mit30 DNA segment, Chr 1, Massachusetts Institute of Technology 30
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D1Mit30 b smaller than f C57BL/6J
c 104bp C3HeB/FeJLe
f larger than c and b FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit30 a 102bp SPRET/EiJ
b 104bp A/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, LP/J, NON/ShiLt
c 120bp AKR/J, DBA/2J
d 122bp CAST/EiJ, NOD/MrkTac
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D1Mit30 a 120bp AKR/W, BN/aW, DBA/2W
b 104bp 129/SvW, A.CA/W, BALB/cW, C3H/W, C57BL/6W, C57BL/10W, CBA/W
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory