About   Help   FAQ
D11Mit67 Primer Detail
Primers
  • Name
    D11Mit67
  • Primer 1 Sequence
    AAAAAAAAAAAGTTCAAGGCTGG
  • Primer 2 Sequence
    GGAACTCAACTCCTAGAACTTCTG
  • ID
    MGI:702455
  • Product Size
    134
  • Other IDs
    D11Mit67 (BROAD)
  • Note
    MIT assay: B654
    Additional information: MIT STS Marker Data Files
Genes
D11Mit67 DNA segment, Chr 11, Massachusetts Institute of Technology 67
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D11Mit67 a 126bp 129X1/Sv
f 126, 136bp CD-1
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D11Mit67 c 126bp C3HeB/FeJLe
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit67 a 126bp C3H/HeJ, DBA/2J, LP/J
b 134bp B6.Cg-Lepob/+, C57BL/6J
c 136bp BALB/cJ, NOD/MrkTac, NON/ShiLt
d 152bp SPRET/EiJ
e 178bp A/J, AKR/J, CAST/EiJ
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D11Mit67 a smaller 129P3/J
s larger SJL/J
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory