D11Mit61 Primer Detail MGI Mouse MGI:702453

D11Mit61 Primer Detail

Name

D11Mit61
Primer 1 Sequence

ACCCTTTCTCAGCTTACAAGTCC
Primer 2 Sequence

GTATCAGAATCTGGTGCTTCTGG
ID

MGI:702453
Product Size

128
Other IDs

D11Mit61 (BROAD)
Note

MIT assay: P43
Additional information: MIT STS Marker Data Files

D11Mit61

DNA segment, Chr 11, Massachusetts Institute of Technology 61

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D11Mit61	a	146bp	129X1/Sv
Not Specified	D11Mit61	f	140, 142bp	CD-1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit61	c	184bp	C3HeB/FeJLe
	D11Mit61	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit61	a	132bp	CAST/EiJ
	b	138bp	SPRET/EiJ
	c	140bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, LP/J
	d	142bp	BALB/cJ
	e	144bp	NOD/MrkTac
	f	146bp	NON/ShiLt
	g	184bp	A/J, C3H/HeJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit61	c	198bp	CBA/CaOlaHsd
	D11Mit61	s	197bp	SWR/OlaHsd

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24