About   Help   FAQ
D11Mit61 Primer Detail
Primers
  • Name
    D11Mit61
  • Primer 1 Sequence
    ACCCTTTCTCAGCTTACAAGTCC
  • Primer 2 Sequence
    GTATCAGAATCTGGTGCTTCTGG
  • ID
    MGI:702453
  • Product Size
    128
  • Other IDs
    D11Mit61 (BROAD)
  • Note
    MIT assay: P43
    Additional information: MIT STS Marker Data Files
Genes
D11Mit61 DNA segment, Chr 11, Massachusetts Institute of Technology 61
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D11Mit61 a 146bp 129X1/Sv
f 140, 142bp CD-1
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D11Mit61 c 184bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit61 a 132bp CAST/EiJ
b 138bp SPRET/EiJ
c 140bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J, LP/J
d 142bp BALB/cJ
e 144bp NOD/MrkTac
f 146bp NON/ShiLt
g 184bp A/J, C3H/HeJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D11Mit61 c 198bp CBA/CaOlaHsd
s 197bp SWR/OlaHsd
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/09/2025
MGI 6.24
The Jackson Laboratory