About   Help   FAQ
D11Mit60 Primer Detail
Primers
  • Name
    D11Mit60
  • Primer 1 Sequence
    AGAGAGGCAAAAATTCCAAGC
  • Primer 2 Sequence
    CTTCCTGATGGTAGGATTTAGGC
  • ID
    MGI:702452
  • Product Size
    301
  • Other IDs
    D11Mit60 (BROAD)
  • Note
    MIT assay: D633
    Additional information: MIT STS Marker Data Files
Genes
D11Mit60 DNA segment, Chr 11, Massachusetts Institute of Technology 60
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D11Mit60 b larger C57BL/6J
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit60 a 308bp A/J, AKR/J, BALB/cJ, CAST/EiJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
b 312bp C3H/HeJ
c 316bp B6.Cg-Lepob/+, C57BL/6J
d 344bp SPRET/EiJ
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/14/2026
MGI 6.24
The Jackson Laboratory