About   Help   FAQ
D11Mit62 Primer Detail
Primers
  • Name
    D11Mit62
  • Primer 1 Sequence
    GAATAACCCATGTTTATATCGGTG
  • Primer 2 Sequence
    CTCTGGACTTGTGTTCTATGCC
  • ID
    MGI:702450
  • Product Size
    150
  • Other IDs
    D11Mit62 (BROAD)
  • Note
    MIT assay: B668
    Additional information: MIT STS Marker Data Files
Genes
D11Mit62 DNA segment, Chr 11, Massachusetts Institute of Technology 62
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit62 a 148bp B6.Cg-Lepob/+, C57BL/6J
b 160bp A/J, AKR/J, BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac, NON/ShiLt
c 168bp SPRET/EiJ
d 170bp CAST/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D11Mit62 l larger LG/J
s smaller SM/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory