About   Help   FAQ
D3Mit127 Primer Detail
Primers
  • Name
    D3Mit127
  • Primer 1 Sequence
    CCTTCTGACAAGCAGGATTTG
  • Primer 2 Sequence
    TTTCTAGCATCTCCAAGCAGG
  • ID
    MGI:702440
  • Product Size
    175
  • Other IDs
    D3Mit127 (BROAD)
  • Note
    MIT assay: MT177
    Additional information: MIT STS Marker Data Files
Genes
D3Mit127 DNA segment, Chr 3, Massachusetts Institute of Technology 127
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit127 a 106bp CAST/EiJ
b 132bp DBA/2J
c 168bp A/J, AKR/J, BALB/cJ, C3H/HeJ, LP/J, NON/ShiLt
d 176bp B6.Cg-Lepob/+, C57BL/6J
e 188bp SPRET/EiJ
f 240bp NOD/MrkTac
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D3Mit127 a larger 129P3/J
s smaller SJL/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D3Mit127 a 262bp CBA/W
b 176bp C57BL/6W, C57BL/10W
c 168bp 129/SvW, A.CA/W, AKR/W, BALB/cW, BN/aW, C3H/W
d 132bp DBA/2W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory