About   Help   FAQ
D4Mit42 Primer Detail
Primers
  • Name
    D4Mit42
  • Primer 1 Sequence
    CATGTTTGCCACCCTGAAAC
  • Primer 2 Sequence
    CCTCACTTAGGCAGGTGACTC
  • ID
    MGI:702438
  • Product Size
    100
  • Other IDs
    D4Mit42 (BROAD)
  • Note
    MIT assay: J5
    Additional information: MIT STS Marker Data Files
Genes
D4Mit42 DNA segment, Chr 4, Massachusetts Institute of Technology 42
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D4Mit42 b larger C57BL/6J
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit42 a 88bp SPRET/EiJ
b 91bp DBA/2J
c 94bp C3H/HeJ, LP/J
d 98bp AKR/J, NOD/MrkTac, NON/ShiLt
e 102bp A/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J
f 118bp CAST/EiJ
J:68682 Li X, et al., Mamm Genome. 2001 Jan;12(1):13-6
Endonuclease Gene Allele Fragments Strains
D4Mit42 a bigger C57BL/6ByJ
b smaller 129P3/J
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D4Mit42 a larger 129P3/J
s smaller SJL/J
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:68682 Li X, et al., High-resolution genetic mapping of the saccharin preference locus (Sac) and the putative sweet taste receptor (T1R1) gene (Gpr70) to mouse distal Chromosome 4. Mamm Genome. 2001 Jan;12(1):13-6
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory