About   Help   FAQ
D10Mit96 Primer Detail
Primers
  • Name
    D10Mit96
  • Primer 1 Sequence
    CTTCTTTGAAGTTAGATGCAGCC
  • Primer 2 Sequence
    TACGGAGAAGGGAACACCTG
  • ID
    MGI:702435
  • Product Size
    150
  • Other IDs
    D10Mit96 (BROAD)
  • Note
    MIT assay: MPC2327
    Additional information: MIT STS Marker Data Files
Genes
D10Mit96 DNA segment, Chr 10, Massachusetts Institute of Technology 96
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit96 a 127bp C3H/HeJ, NOD/MrkTac
b 149bp AKR/J
c 153bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, DBA/2J, LP/J, NON/ShiLt
d 155bp A/J
e 165bp SPRET/EiJ
f 171bp CAST/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D10Mit96 l smaller LG/J
s larger SM/J
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D10Mit96 e lower KE
k upper CBA/Kw
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory