D10Mit132 Primer Detail MGI Mouse MGI:702420

D10Mit132 Primer Detail

Name

D10Mit132
Primer 1 Sequence

ACTCCAGGTTTACTGAGCAACC
Primer 2 Sequence

TGCTGATGTTTTAACAAATGGC
ID

MGI:702420
Product Size

143
Other IDs

D10Mit132 (BROAD)
Note

MIT assay: MT1259
Additional information: MIT STS Marker Data Files

D10Mit132a	DNA segment, Chr 10, Massachusetts Institute of Technology 132a
D10Mit132b	DNA segment, Chr 10, Massachusetts Institute of Technology 132b

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit132a	a	139bp	AKR/J
	b	143bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
	c	145bp	DBA/2J
	d	153bp	CAST/EiJ
	e	159bp	SPRET/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D10Mit132a	c	145bp	129P3/J, A/JOlaHsd, AKR/OlaHsd, BALB/cJ, C57BL/6JOlaHsd, SJL/J
	d	147bp	C3H/HeJ, C57BL/10, DBA/2J
	p	155bp	JF1, PWB

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit132a	l	smaller	LG/J
	D10Mit132a	s	larger	SM/J

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/30/2025 MGI 6.24