About   Help   FAQ
D10Mit134 Primer Detail
Primers
  • Name
    D10Mit134
  • Primer 1 Sequence
    AATCCTAGAAGATACATGCTGATGC
  • Primer 2 Sequence
    AGTTAAGCACCAAAATTGAAATCA
  • ID
    MGI:702414
  • Product Size
    100
  • Other IDs
    D10Mit134 (BROAD)
  • Note
    MIT assay: MTH192
    Additional information: MIT STS Marker Data Files
Genes
D10Mit134 DNA segment, Chr 10, Massachusetts Institute of Technology 134
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit134 a 85bp SPRET/EiJ
b 93bp AKR/J, C3H/HeJ, LP/J, NOD/MrkTac, NON/ShiLt
c 101bp B6.Cg-Lepob/+, C57BL/6J
d 111bp CAST/EiJ
e 119bp BALB/cJ
f 125bp A/J, DBA/2J
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D10Mit134 a 87bp 129P3/J, AKR/OlaHsd, C3H/HeJ
b 95bp C57BL/6JOlaHsd, C57BL/10
d 115bp A/JOlaHsd, BALB/cJ, DBA/2J
j 109bp JF1
l 111bp SJL/J
p 89bp PWB
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D10Mit134 l smaller LG/J
s larger SM/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D10Mit134 a 125bp A.CA/W, BALB/cW, DBA/2W
b 101bp 129/SvW, C57BL/6W, C57BL/10W, CBA/W
c 93bp AKR/W, BN/aW, C3H/W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
05/28/2024
MGI 6.13 		The Jackson Laboratory