D2Mit365 Primer Detail MGI Mouse MGI:702398

D2Mit365 Primer Detail

Name

D2Mit365
Primer 1 Sequence

GAGATCCCACTGATGATACAAGC
Primer 2 Sequence

AGATGTGCCCAAGGGTCC
ID

MGI:702398
Product Size

100
Other IDs

D2Mit365 (BROAD)
Note

MIT assay: MTH338
Additional information: MIT STS Marker Data Files

D2Mit365

DNA segment, Chr 2, Massachusetts Institute of Technology 365

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D2Mit365	a	88bp	CAST/EiJ
	b	90bp	SPRET/EiJ
	c	100bp	NOD/MrkTac, NON/ShiLt
	d	102bp	B6.Cg-Lep^ob/+, C57BL/6J
	e	106bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J
	f	108bp	LP/J

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D2Mit365	b	98bp	C57BL/6JOlaHsd
	d	102bp	A/JOlaHsd, AKR/OlaHsd, BALB/cJ, C3H/HeJ, DBA/2J, SJL/J
	g	104bp	129P3/J, C57BL/10
	j	92bp	JF1
	p	82bp	PWB

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/28/2024 MGI 6.13