About   Help   FAQ
D3Mit268 Primer Detail
Primers
  • Name
    D3Mit268
  • Primer 1 Sequence
    GGGATTTTAAAGCAAAGCCC
  • Primer 2 Sequence
    TCATGCACACACATGAACATG
  • ID
    MGI:702356
  • Product Size
    103
  • Other IDs
    D3Mit268 (BROAD)
  • Note
    MIT assay: MT3545
    Additional information: MIT STS Marker Data Files
Genes
D3Mit268 DNA segment, Chr 3, Massachusetts Institute of Technology 268
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit268 a 106bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
b 118bp SPRET/EiJ
c 122bp A/J, C3H/HeJ, CAST/EiJ, DBA/2J
d 130bp AKR/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D3Mit268 a 130bp AKR/W
b 122bp A.CA/W, C3H/W, CBA/W, DBA/2W
c 112bp BN/aW
d 106bp 129/SvW, BALB/cW, C57BL/6W, C57BL/10W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory