About   Help   FAQ
D11Mit156 Primer Detail
Primers
  • Name
    D11Mit156
  • Primer 1 Sequence
    CCCTGCCCTGAGTGTCTCT
  • Primer 2 Sequence
    GAGGGACAGTGAGTGTCAAGC
  • ID
    MGI:702347
  • Product Size
    111
  • Other IDs
    D11Mit156 (BROAD)
  • Note
    MIT assay: MT556
    Additional information: MIT STS Marker Data Files
Genes
D11Mit156 DNA segment, Chr 11, Massachusetts Institute of Technology 156
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit156 a 117bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J, LP/J, SPRET/EiJ
b 119bp AKR/J, CAST/EiJ, NOD/MrkTac, NON/ShiLt
c 121bp BALB/cJ
d 125bp A/J, C3H/HeJ
J:156851 Golas A, MGI Direct Data Submission. 2010;
Endonuclease Gene Allele Fragments Strains
D11Mit156 b upper C57BL/6J
s lower 129/Sv
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:156851 Golas A, Microsatellite differences on Chromosome 3, 6, 11 and 12 in C57BL/6J and 129/Sv strains and Mapping in CBXE RI line. MGI Direct Data Submission. 2010;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/21/2024
MGI 6.23
The Jackson Laboratory